Bioinformatics Literature Review

4563 Words19 Pages
Introduction to Bioinformatics Fig.1:-Branches of Bioinformatics
Bioinformatics is a type of interdisciplinary field which has all developed method and software tools for all the biological data and to understand it. Bioinformatics is a combination of many fields of subjects to study and for the processing of the biological data.
Bioinformatics are used repeatedly in the fields of genetics and genomics. Commonly it is used for the identification of genes and nucleotides of a particular person. It is based on the organizational principles within nucleic acid and protein sequences.

9
SSR PREDICTION AND PHYLOGENETIC ANALYSIS IN FAGOPYRUM
REVIEW of Literature
I.PHYLOGENETICS
Phylogenetics is the study of evolutionary relationships among the group of organisms as
…show more content…
Parapteropyrum tibeticum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Accession:
JN187103.1
GI:
342356518
SSRs found in your sequence(s)
Sequence Motif No.of Repeats SSR start SSR end SeqLength
TCGAAACCTGCCCGAAAGCAGAGAGACCCGCGGACCCGTACCGAAAACGCGCGCGGGGCGGGCTAGCGAT-1 Ga 5 523 532 548
TCGAAACCTGCCCGAAAGCAGAGAGACCCGCGGACCCGTACCGAAAACGCGCGCGGGGCGGGCTAGCGAT-2 ccg 4 10 21 548

9. Parapteropyrum tibeticum tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, partial sequence; chloroplast
Accession:
EU109589.1
GI:
157057722
SSRs found in your sequence(s)
Sequence Motif No.of Repeats SSR start SSR end SeqLength
ATTCAGAGAAACCCTGGAATAAAAAAACGGATAATCCTGAGCCAACTCCTGCTTTACAAAAGAAAGAAWW-1 Aat 3 151 159 791

31
10. Parapteropyrum tibeticum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Accession:

More about Bioinformatics Literature Review

Open Document